View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8259_low_10 (Length: 249)
Name: NF8259_low_10
Description: NF8259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8259_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 4306733 - 4306943
Alignment:
| Q |
16 |
aatactgcaggcagaacaaggtaacagtaatgcacgtcacgtagtgcatgtgcttggtttcatcatccacatgcacactattttaattcactactagcta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4306733 |
aatactgcaggcagaacaaggtaacagtaatgcacgtcacgtagtgcatgtgcttggtttcatcatccacatgcacactattttaattcactactagcta |
4306832 |
T |
|
| Q |
116 |
cttccttctcctattttagtcatattctcattcatgtgggttaatttcaattcggcagtctcctccatcctagtacatgtataagctccttttctttatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4306833 |
cttccttctcctattttagtcatattctcattcatgtgggttaatttaaattcggcagtctcctccatcctagtacatgtataagctccttttctttatc |
4306932 |
T |
|
| Q |
216 |
gtcatcaatcg |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
4306933 |
gtcatcaatcg |
4306943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University