View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8259_low_13 (Length: 228)
Name: NF8259_low_13
Description: NF8259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8259_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 46820553 - 46820360
Alignment:
| Q |
18 |
agatcaagataggtcttgttgacatcaatccaagatcaatcggtgaacaattagatgtaaatcgatcacgagtagacattgtacctattcattttgaccg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46820553 |
agatcaagataggtcttgttgacatcaatccaagatcaatcggtgaacaattagatggaaatcgatcacgagtagacattgtacctattcattttgaccg |
46820454 |
T |
|
| Q |
118 |
tgttagcgagaatttgaaatggagtgacttttttccagaatggattgatgaggaaggaaaaccggacgagcctaaatgtccaaacatgcctatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46820453 |
tgttagcgagaatttgaaatggagtgacttttttccagaatggattgatgaggaaggaaaaccggacgagcctaaatgtccaaacatgcctatg |
46820360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University