View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_high_22 (Length: 322)
Name: NF8260A_high_22
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 304
Target Start/End: Complemental strand, 29847428 - 29847137
Alignment:
| Q |
13 |
gagatagtgaaagaagaaggtatgaagcaaaagagagtggcaatggtgcagagaagtagaagagttgtgaggaaaagtttgtgttctgcagcatagtttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847428 |
gagatagtgaaagaagaaggtatgaagcaaaagagagtggcaatggtgcagagaagtagaagagttgtgaggaaaagtttgtgttctgcagcatagtttc |
29847329 |
T |
 |
| Q |
113 |
ttgatgaccaaagaaagagcttcttctctttgtctttgatggccattgaaatgtgtggaaatggaagcaagtgctttggagtgagtgtgatgannnnnnn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847328 |
ttgatgaccaaagaaagagcttcttctctttgtctttgatggccattgaaatgtgtggaaatggaagcaagtgctttggagtgagtgtgatgagttgtgt |
29847229 |
T |
 |
| Q |
213 |
nnnnnnnnnnnnnnatatattaggaaactttttggttgttaaggtttagggacaaatgagattcgtttttggagaaattaggataattattg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847228 |
tgtgttgtgttgtgatatattaggaaactttttggttgttaaggtttagggacaaatgagattcgtttttggagaaattaggataattattg |
29847137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University