View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_118 (Length: 330)
Name: NF8260A_low_118
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_118 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 24 - 329
Target Start/End: Complemental strand, 6236647 - 6236342
Alignment:
| Q |
24 |
ctcaccacccagctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctgtttttgtttc |
123 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6236647 |
ctcaccaccctgctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctatttttgtttc |
6236548 |
T |
 |
| Q |
124 |
ttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttcgcttgatcnnnnnnnnnnnnttagattttcacctatcaccta |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6236547 |
ttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttcgcttgataaaaaaaaaaaaattagattttcacctatcaccta |
6236448 |
T |
 |
| Q |
224 |
ggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactataatttagaaacacca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6236447 |
ggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactaaaatttagaaacacca |
6236348 |
T |
 |
| Q |
324 |
tgatat |
329 |
Q |
| |
|
|||||| |
|
|
| T |
6236347 |
tgatat |
6236342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 307
Target Start/End: Original strand, 33891807 - 33891908
Alignment:
| Q |
202 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
301 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
 |
| Q |
302 |
acacta |
307 |
Q |
| |
|
|||||| |
|
|
| T |
33891903 |
acacta |
33891908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 307
Target Start/End: Complemental strand, 33952441 - 33952340
Alignment:
| Q |
202 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
301 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
 |
| Q |
302 |
acacta |
307 |
Q |
| |
|
|||||| |
|
|
| T |
33952345 |
acacta |
33952340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University