View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_132 (Length: 321)
Name: NF8260A_low_132
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_132 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 160 - 321
Target Start/End: Original strand, 10392582 - 10392743
Alignment:
| Q |
160 |
gcgtagaagtgatagaattggcttctgtacctaactactaaattagcacgaaagcaaacaccataaatgaattccaacagaaagcatttgccaccacgaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10392582 |
gcgtagaagtgatagaattggcttctgtagctaattactaaaccaccacgaaagcaaacaccataaatgaattccaacagaaagcatttgccaccacgaa |
10392681 |
T |
|
| Q |
260 |
atgcattaaatgaatagtagtagtacgtgtttatttttggtttacataattattattcgaga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10392682 |
atgcattaaatgaatagtagtagtacgtgtttatttttggtttacataattattattcgaga |
10392743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University