View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_134 (Length: 320)
Name: NF8260A_low_134
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_134 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 314
Target Start/End: Original strand, 37764729 - 37765025
Alignment:
| Q |
12 |
tgttccttgcgcctccttaaaactgcaaaaataacttttttacttttggattttggaattcgaataccatttataatgtgcatgtttcattctagtagta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37764729 |
tgtttcttgcgcctccttaaaactgcaaaaataacttatatacttttggattttggaattcgaataccatttataatgtgcatgtttcattctagtagaa |
37764828 |
T |
|
| Q |
112 |
gtgaggatattaatcgcggtttaaccatggataaccgctttattgaatgcactgtgcactgtgtacttatggtgcacacaaaggtgacaatgttttatga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37764829 |
gtgaggatattaatcgcggtttaaccatggataaccgctttattgaa-------tgcactgtgtacttatggtgcacacaaaggtgacaatgttttatga |
37764921 |
T |
|
| Q |
212 |
ggcctctctctataggggatgaatcaagtgcagtttgaagatgtatgcatatcttttggacatggtacaacac--cacaccagtactaacatgtaccgag |
309 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37764922 |
ggcctctctgtata-gggatgaatcaagtgcagtttgaagatgtatgcatatcttttggacatggtacaacaccacacaccagtactaacatgtaccgag |
37765020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University