View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_135 (Length: 320)
Name: NF8260A_low_135
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_135 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 70 - 277
Target Start/End: Complemental strand, 5042964 - 5042757
Alignment:
| Q |
70 |
tgtacatgattgtacaaatatcatttctcatatcaaagtaaaaaatacggtgttgannnnnnnnnnnnngtttaattatctagctgtaaatccatgtccg |
169 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
5042964 |
tgtacatgattgtataaatatcatttctcatatcaaagtaaaaaatacggtgttgatttttacttttttgtttaattatctagctgtaaatccatgtctg |
5042865 |
T |
 |
| Q |
170 |
tttgtgtgagcttgtcactcacatcagatatagtaaaacttattctatttgtggttctaatgcttaataattgtcttctcatattacatggtaaatgatt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042864 |
tttgtgtgagcttgtcactcacatcagatatagtaaaacttattctatttgtggttctaatgcttaataattgtcttctcatattacatggtaaatgatt |
5042765 |
T |
 |
| Q |
270 |
tttgaaag |
277 |
Q |
| |
|
|||||||| |
|
|
| T |
5042764 |
tttgaaag |
5042757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 104
Target Start/End: Complemental strand, 9311063 - 9311034
Alignment:
| Q |
75 |
atgattgtacaaatatcatttctcatatca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9311063 |
atgattgtacaaatatcatttctcatatca |
9311034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University