View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_143 (Length: 314)
Name: NF8260A_low_143
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_143 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 207 - 314
Target Start/End: Complemental strand, 5402076 - 5401969
Alignment:
| Q |
207 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402076 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
5401977 |
T |
 |
| Q |
307 |
gatacgtg |
314 |
Q |
| |
|
|||||||| |
|
|
| T |
5401976 |
gatacgtg |
5401969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 5402272 - 5402216
Alignment:
| Q |
16 |
atgaagggttggaaccaaattggtatcattgaaaccatttacgaggaagaacgtgaa |
72 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5402272 |
atgaagggttggaaccaaattggtgtcattgaaaccatttacgaggaagaacgtgaa |
5402216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University