View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_148 (Length: 311)
Name: NF8260A_low_148
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_148 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 43239043 - 43239342
Alignment:
| Q |
1 |
tgttgtaacttttatgtttattttatgtttttcatgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaaca |
100 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239043 |
tgttttaacttttatgtttcttttatttttttcatgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaaca |
43239142 |
T |
 |
| Q |
101 |
tcattaatgagtgtttcattcaatttgcagattcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239143 |
tcattaatgggtgtttcattcaatttgcagattcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaa |
43239242 |
T |
 |
| Q |
201 |
cctgataatggttccattaggttggacatggggtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239243 |
cctgataatggttccattaggttggacatggggtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
43239342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University