View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_157 (Length: 304)
Name: NF8260A_low_157
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_157 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 49 - 292
Target Start/End: Original strand, 21228591 - 21228835
Alignment:
| Q |
49 |
ttacatgtccaaacacaaacctctctatgtttgtttgtttatatatcaaacatctattgttaaaatcaagtaatctgataaagtattatatagtaattga |
148 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228591 |
ttacttgtccaaacacaaacctcactatgtttgtttgtttatatatcaaacatctatagttaaaatcaagtaatctgataaagtattatatagtaattga |
21228690 |
T |
|
| Q |
149 |
tttgaatggaatattgtaaacttgaaacacc-tataagaactttcaaaatggatggttggattgtttagttttgcattctacaaaatattattcagtggt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228691 |
tttgaatggaatattgtaaacttgaaacaccttataagaactttcaaaatggatggatggattgtttagttttgcattctacaaaatattattcagtggt |
21228790 |
T |
|
| Q |
248 |
gtaatgtaaaagtttgtctcaagagtcaattagctgggtcatatt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228791 |
gtaatgtaaaagtttgtctcaagagtcaattagctgggtcatatt |
21228835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 21228523 - 21228566
Alignment:
| Q |
7 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228523 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
21228566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 263
Target Start/End: Original strand, 10035699 - 10035758
Alignment:
| Q |
204 |
ttggattgtttagttttgcattctacaaaatattattcagtggtgtaatgtaaaagtttg |
263 |
Q |
| |
|
|||||||| || | |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10035699 |
ttggattggttcggtttgcattctacaatttattattcgctggtgtaatgtaaaagtttg |
10035758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University