View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_178 (Length: 289)
Name: NF8260A_low_178
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_178 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 25933214 - 25933436
Alignment:
| Q |
11 |
agaatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933214 |
agaatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttt |
25933313 |
T |
 |
| Q |
111 |
ttattaaactaagttgaacgccctttctctaaaaatcagaaagttaacatcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25933314 |
ttattaaactaagttgaacgccctttctctgaaaatcagaaagttaacatcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacata |
25933413 |
T |
 |
| Q |
208 |
ctacttgttatattctttcatcc |
230 |
Q |
| |
|
| | |||||||||| |||||||| |
|
|
| T |
25933414 |
caatttgttatattatttcatcc |
25933436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University