View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_221 (Length: 268)
Name: NF8260A_low_221
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_221 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 13 - 138
Target Start/End: Original strand, 8884952 - 8885077
Alignment:
| Q |
13 |
aatatcgcatatcaaggctcaaatataaaattaatatttacatttagtaccgacacgtcttgaatagaattattattattttgttacattcaaatagaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884952 |
aatatcgcatatcaaggctcaaatataaaattaatatttacatttagtaccggcacatcttgaatagaattattattattttgttacattcaaatagaat |
8885051 |
T |
 |
| Q |
113 |
tatctataatgcataaaatataatgg |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8885052 |
tatctataatgcataaaatataatgg |
8885077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 170 - 268
Target Start/End: Original strand, 8885109 - 8885207
Alignment:
| Q |
170 |
gaccatcaaagaaggttacaaaggcaacatagaatatctagtcataatatgtagaggcgcttaaagtcagtctcaaaaaccaactaaagacattgtaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
8885109 |
gaccatcaaagaaggttacaaaggcaacatagaatatctagtcataatatgtggaggcgcttaaagtcagtttcaaaaaccaactaaagatattgtaag |
8885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University