View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_256 (Length: 255)
Name: NF8260A_low_256
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_256 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 32045548 - 32045358
Alignment:
| Q |
1 |
ggcgttggtgcctcattattttcagtagagaggtcctatggggagatgttatgttagctcgatacggtggtggatctcttcatgatcatcgtggtgggcg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
32045548 |
ggcgttgctgcctcattattttcagtagagaggtcttatggggagatgttatgttagctcgttatggtggtggatctcttcttgatcatcgtggtgggca |
32045449 |
T |
 |
| Q |
101 |
ccctatgggctttcgatccatttcatgttggtggaaagatgtttccttgctcgggtttgcta-tgaagacttggggcaccgggtcctcacac |
191 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
32045448 |
ccctctaggctttcgatccatttcatgttggtggaaagatgtttccttgctcgggtttgctacggaagacttggggcacc-ggtcctcacac |
32045358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 193 - 240
Target Start/End: Complemental strand, 32045321 - 32045274
Alignment:
| Q |
193 |
tccttctggaatgacctcttgcttgggaatgctcctttgaggatatat |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32045321 |
tccttctggaatgactccttgcttgggaatgctcctttgaggatatat |
32045274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University