View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_257 (Length: 255)
Name: NF8260A_low_257
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_257 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 255
Target Start/End: Complemental strand, 24211105 - 24210856
Alignment:
| Q |
6 |
aaattcaactttggatgagataaagaattggatgaaagagtgggaaccatggatggttatagttaagattttccaacaagttcacactctttgtttcaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211105 |
aaattcaactttggatgagataaagaattggatgaaagagtgggaaccatggatggttatagttaagattttccaacaagttcacactctttgtttcaac |
24211006 |
T |
|
| Q |
106 |
tatagaacatgttttttggtttgtgaaacattaacatagtgatgtttatctttggctttggaccgttaatctagtttggtgtttgtgggaattatcttga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211005 |
tatagaacatgttttttggtttgtgaaacataaacatagtaatgtttatctttggctttggaccgttaatctagtttggtgtttgtgggaattatcttga |
24210906 |
T |
|
| Q |
206 |
atagaagaggtaagctagatgtagcgaattggatttagccacgtaatcag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24210905 |
atagaagaggtaagctagatgtagcgaattggatttagccacgtaatcag |
24210856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University