View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_279 (Length: 250)
Name: NF8260A_low_279
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_279 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 2134041 - 2133851
Alignment:
| Q |
16 |
agatattactaatcaatggaaaacactgaagagcaagagttgttgtgattcacatatcatactactcaataattcataaacctacgatactacctcttag |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2134041 |
agatattactaatcaatggaaaacacttaagagcaagagttgttgtgattcacatatcatactactcaataattcataaacctacgatactacctcttag |
2133942 |
T |
|
| Q |
116 |
tcttagtaataaggtgtaccaagttttttaatttgtcaagaaatgagaaaagaatatagagttggggtcatttgggaatttgtattagctag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2133941 |
tcttagtaataaggtgtaccaagttttttaatttgtcaagaaatgagaaaagaatatagagttggggtcatttgggaa-ttgtattagctag |
2133851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University