View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_311 (Length: 246)
Name: NF8260A_low_311
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_311 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 44611393 - 44611605
Alignment:
| Q |
13 |
atggacatcatttcgtgacgcatatgcgaagaatatgtttgttgaatataaagataaaatgaatatttcttaggtttagtggattataggttcagtgatt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44611393 |
atggacaacatttcgtgacgcatatgcgaagaatatgtttgttgaatataaagataaaatgaatatttcttaggtttagtggattataggttcagtgatt |
44611492 |
T |
|
| Q |
113 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44611493 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactgtttttcaggtttacagctt |
44611592 |
T |
|
| Q |
213 |
tcgatggcttcat |
225 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
44611593 |
tcgatggtttcat |
44611605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 113 - 212
Target Start/End: Original strand, 13146114 - 13146213
Alignment:
| Q |
113 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctt |
212 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
13146114 |
tgtttatgctgctattggtttgtgctctgctgtctttttggtcttgagatcttcctagggttttggcttctgatgctattgtttttcaggtttacagctt |
13146213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 113 - 205
Target Start/End: Complemental strand, 26379661 - 26379569
Alignment:
| Q |
113 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggttt |
205 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26379661 |
tgtttctactgttattggtttgtgctctgctgtttttttggtcttgagatctttctagggttttggcttctgatgctactatttttcaggttt |
26379569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 208
Target Start/End: Original strand, 22247022 - 22247058
Alignment:
| Q |
172 |
attttggcttctgatgctactatttttcaggtttaca |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22247022 |
attttggcttttgatgctactatttttcaggtttaca |
22247058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University