View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_314 (Length: 246)
Name: NF8260A_low_314
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_314 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 240
Target Start/End: Original strand, 33897812 - 33898032
Alignment:
| Q |
23 |
tgagtttcaaacactatttagcttttttataatttatgtttccatttgagca---cgtcggtggcaatctaagttccataacaaattgcaaagtagctta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897812 |
tgagtttcaaacactatttagcttttttataatttatgtttccatttgagcagcacgtcggtggcaatctaagttccataacaaattgcaaagtagctta |
33897911 |
T |
 |
| Q |
120 |
tttaagccatcgttccatatgaatgtaaattgattatctttgcaaccagtcaacaaaaaagaaaattcagttgtcgtacctcacgagttgcttaaatatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33897912 |
tttaagccatcgttccatatgaatgtaaattgattatctttgcaaccagtcaacaaaaaagaaaattcagttgtcgtaccttacgagttgcttaaatatg |
33898011 |
T |
 |
| Q |
220 |
tattgttggagtaaaaatatt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33898012 |
tattgttggagtaaaaatatt |
33898032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University