View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_336 (Length: 242)
Name: NF8260A_low_336
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_336 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 229
Target Start/End: Complemental strand, 54262570 - 54262363
Alignment:
| Q |
22 |
aagtttcacatctaaatgaagcagcaacattgtagttgtaacatgcaaacatagtacacttggtttgccttgcagttgatactctattgtagctcataat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54262570 |
aagtttcacatctaaatgaagcagcaacattgtagttgtaacatgcaagcatagtacatttggtttgccttgcagttgatactctattgtagctcataat |
54262471 |
T |
|
| Q |
122 |
taccaatacatcgtcttattagttgtagtagaaaactaggtgcgtgcataccaacaattcttcaacgcttcgatgaatgaaattcttcaatgcttcatgt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54262470 |
taccaatacatcgtcttattagttgtagtagaaaactaggtgcgtgcataccaacaattcttcaatgcttcgatgaatgaaattcttcaatgcttcatgt |
54262371 |
T |
|
| Q |
222 |
tcatatca |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
54262370 |
tcatatca |
54262363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University