View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_342 (Length: 241)
Name: NF8260A_low_342
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_342 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 4 - 236
Target Start/End: Complemental strand, 51295670 - 51295453
Alignment:
| Q |
4 |
aatatccacacatcaattctaatatgaaaaattaatatgatatagaataatcaattatgacaagtaagaccaaatatagaagttcacccctctatctcac |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295670 |
aatatccacacatcaattctaatataaaaaattaatatgatatagaataatcaattatgacaagtaagaccaaatatagaagttcacccc---------- |
51295581 |
T |
 |
| Q |
104 |
aataagtgacacatgatcaaactcaataatgtttggcatgaaagggtgaaatgcgaaaaacccatctacttatggcatctctttaagattttcgtttggt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51295580 |
-----gtgacacatgatcaaactcaataatgtttggcgtgaaagggtgaaatgagaaaaacccatatacttatggcatctctttaagattttcgtttggt |
51295486 |
T |
 |
| Q |
204 |
gtgttgatacctactttagataaaagagatcgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51295485 |
gtgttgatacctactttagataaaagagatcgt |
51295453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University