View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_352 (Length: 239)
Name: NF8260A_low_352
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_352 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 29847663 - 29847888
Alignment:
| Q |
1 |
tggtctttctgtaaagacacttcatgttaatggaaatcctacgtatgaatgtgagtggatccctaacactaacacaaccacaaactcttcaaaaaacatc |
100 |
Q |
| |
|
|||||||||| |||| | ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29847663 |
tggtctttcttcaaagcctcttcatgtttatggaaatcctacttatgaatgtgagtggatccctaacactaacacaaacacaaactcttcaaaaaacatc |
29847762 |
T |
|
| Q |
101 |
accaccattggttacaagatgctccctgattggggctatggccatgtttatactgttgtgattgttaactgcactttcaatgaatcaatcaatgttgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847763 |
accaccattggttacaagatgctccctgattggggctatggccatgtttataccgttgtgattgttaactgcactttcaatgaatcaatcaatgttgata |
29847862 |
T |
|
| Q |
201 |
acaatggtggaaagttgatgctatat |
226 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
29847863 |
acagtggtggaaagttgatgctatat |
29847888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 14831107 - 14831039
Alignment:
| Q |
110 |
ggttacaagatgctccctgattggggctatggccatgtttatactgttgtgattgttaactgcactttc |
178 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||| |||||| || || || || |||||||| |||||| |
|
|
| T |
14831107 |
ggttacaagatcctccctgactggggctacggccgtgtttacacggtcgtaatcgttaactgtactttc |
14831039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University