View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_355 (Length: 238)
Name: NF8260A_low_355
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_355 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 7 - 176
Target Start/End: Complemental strand, 410769 - 410600
Alignment:
| Q |
7 |
tttggtgttggctccaagatgaggagtggcaatcacattctcatgttgcactaacttactgtctttggctggaggctcctcagtgaacacatcaagagct |
106 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410769 |
tttggtgctggctccaagatgaggagtagcaatcacattctcatgttgcactaacttactgtctttggctggaggctcctcagtgaacacatcaagagct |
410670 |
T |
|
| Q |
107 |
gcctgctccaagttcaaacaaaatagaaatgtcatttgaatggttaacagataaatcattaatttcaaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
410669 |
gcctgctccaagttcaaacaaaatagaaatgtcatttgaatggttaacagataactaattaatttcaaat |
410600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 200 - 238
Target Start/End: Complemental strand, 410530 - 410492
Alignment:
| Q |
200 |
ttgacctgagcaccaattccactatcaagagctttgact |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
410530 |
ttgacctgagcaacaattccactatcaagagctttgact |
410492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University