View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_358 (Length: 238)
Name: NF8260A_low_358
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_358 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 3429509 - 3429300
Alignment:
| Q |
10 |
caaaaacagagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacact |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3429509 |
caaaaacaaagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacact |
3429410 |
T |
|
| Q |
110 |
ccaatcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429409 |
ccaatcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaaca |
3429310 |
T |
|
| Q |
210 |
accaagatgg |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
3429309 |
accaagatgg |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 3426021 - 3425822
Alignment:
| Q |
19 |
agaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatccca |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
3426021 |
agaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgcca |
3425922 |
T |
|
| Q |
119 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
218 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||||| |
|
|
| T |
3425921 |
tatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University