View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_379 (Length: 231)
Name: NF8260A_low_379
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_379 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 53 - 231
Target Start/End: Original strand, 37721239 - 37721417
Alignment:
| Q |
53 |
caataatctcaagaaagaaagcggcattatatattagtattaccagcttgttttctctcggtggaagaaccacttctctgaagaatttcaaggtcaacaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721239 |
caataatctcaagaaagaaagcggcattatatattagtattaccagcttgttttctctcggtggaagaaccacttctctgaagaatttcaaggtcaacag |
37721338 |
T |
|
| Q |
153 |
gacgtttagacattaaaccaagcgtaagaccagacatgataccagcaaagagaacaagcgagaaagaaactccggcgta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721339 |
gacgtttagacattaaaccaagcgtaagaccagacatgataccagcaaagagaacaagcgagaaagaaactccggcgta |
37721417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University