View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_385 (Length: 230)
Name: NF8260A_low_385
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_385 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 36529979 - 36529761
Alignment:
| Q |
6 |
aagaagacagaaagacagtgaaagtgtaaagtgtttaaaacaccagcgacttagaagaggagggaagtacaaagcgggaaacgaaaaaatttcgcaactt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36529979 |
aagaagacagaaagacagtgaaagtgtaaagtgtttaaaacaccagtgacttagaagaggagggaagtacaaagcgggaaacgaaaaattttcgcaactt |
36529880 |
T |
|
| Q |
106 |
ttcatttcctcccaaattttcactcaaactaaattttccgaccaannnnnnnnactattttattcatgttttaattttccctcaaaaactcttttatgat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529879 |
ttcatttcctcccaaattttcactcaaactaaattttccgaccaa-tttttttactattttattcatgttttaattttccctcaaaaactcttttatgat |
36529781 |
T |
|
| Q |
206 |
tactatgagattaatttttt |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36529780 |
tactatgagattaatttttt |
36529761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University