View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_409 (Length: 230)
Name: NF8260A_low_409
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_409 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 6358480 - 6358263
Alignment:
| Q |
1 |
attacgagagagtcaaatccacaaaaacatcataaccgtatctaaaacaaaatgtgtaaatccccataagcttaaccttgtgagtggtctgtaatcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358480 |
attacgagagagtcaaatccacaaaaacatcataaccgtatctaaaacaaaatgtgtaaatccccataagcttaaccttgtgagtggtctgtaatcccca |
6358381 |
T |
|
| Q |
101 |
tatcattatcaactaatttatgttttgaagcataaacctttggnnnnnnnntctgcaatctctttaatattgatttctgtcgctcctcaatgtctcaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6358380 |
tatcattatcaactaatttatgttttgaagcataaacctttgg-aaaaaaatctgcaatctctttaatattgatttctgttgctcctcaatgtctcaagt |
6358282 |
T |
|
| Q |
201 |
tcgattctccttaatgtct |
219 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
6358281 |
tcgattctcctcaatgtct |
6358263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University