View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_413 (Length: 229)
Name: NF8260A_low_413
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_413 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 30775472 - 30775596
Alignment:
| Q |
1 |
ttttgcaatgatcatcaacaaaaatcaagggtagacactcaagtaagttggcatatatctttctcggacggtcaaatgtatgctgcagcttcaaggatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| ||| |||||||| |||| | ||||||||||| ||||| |
|
|
| T |
30775472 |
ttttgcaatgatcatcaacaaaaatcaagggcagtcactcaagcaagttggcatatatcttcctcacacggtcaattgtacgttgcagcttcaaagatta |
30775571 |
T |
|
| Q |
101 |
cctcaagaaatggtttgaagatttt |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
30775572 |
cctcaagaaatagtttgaagatttt |
30775596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 128 - 205
Target Start/End: Original strand, 30775773 - 30775850
Alignment:
| Q |
128 |
tagataccaaatatcaaagccatcctaacaaattttattagaaatagtgataccatccaatgtcacgagcgataatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30775773 |
tagataccaaatatcaaagccatcctaacaaaatttattagaaatagtgataccatccaatgtcaagagcgataatca |
30775850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University