View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_430 (Length: 228)
Name: NF8260A_low_430
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_430 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 39 - 208
Target Start/End: Original strand, 47094264 - 47094433
Alignment:
| Q |
39 |
gagagagagggtttggttttgttgttgaatttggctgagttggagaatgtagtagttgtgagtagtaagaagatgatgaacgtgtttgagtggtttgttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47094264 |
gagagagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaaagtgtttgagtggtttgttt |
47094363 |
T |
 |
| Q |
139 |
tgggtgccattgttgaatagaggtgagatgagtgatgagaatgtttgttgttcatttgaaatagttgtta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47094364 |
tgggtgccattgttgaatagaggtgagatgagtgatgagaatgttttttgttcatttgaaatagttgtta |
47094433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University