View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_445 (Length: 226)
Name: NF8260A_low_445
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_445 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 24101496 - 24101716
Alignment:
| Q |
1 |
ggtttcagaccgcaattcagaactatgttctccgcatcatattgtatgacagtattctgtcacagtatgatgattttgcagcgtctgactatcaaataga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24101496 |
ggtttcagaccgcaattcagaactatgttctccgcatcatattgtatgacagtattctgtcacagtatgatgagtttgcagcgtctgactatcaaataga |
24101595 |
T |
|
| Q |
101 |
aatgaaaattcttggcttttgattaagcccaatttaaagtttaaaccttatgaaaattaagttgtgaataaatacatgtgttagcacataaatagatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24101596 |
aatgaaaattcttggcttttgattaagcccaatttaaagtttaaaccttatgaaaattaagttgtgaataaatacatgtgttagcacataaatagatact |
24101695 |
T |
|
| Q |
201 |
tatattagttttcaaattagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24101696 |
tatattagttttcaaattagt |
24101716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 24617154 - 24617106
Alignment:
| Q |
2 |
gtttcagaccgcaattcagaactatgttctccgcatcatattgtatgac |
50 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24617154 |
gttttagacagcaatttagaactatgttctctgcatcatattgtatgac |
24617106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 24106615 - 24106651
Alignment:
| Q |
2 |
gtttcagaccgcaattcagaactatgttctccgcatc |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
24106615 |
gtttcagaccgcaatttagaactatgttttccgcatc |
24106651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University