View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_458 (Length: 224)
Name: NF8260A_low_458
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_458 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 203
Target Start/End: Original strand, 39495413 - 39495611
Alignment:
| Q |
7 |
atacgatgactaacataacaacttatgtaattatcagttactaatactattaacactgcataatagcttacc--aatatactctacacaatgcctgtatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39495413 |
atacgatgactaacataacaacttatgtaattatcagttactaatactattcacactgcataatagcttaccccaatatactctacacaatgcctgtatt |
39495512 |
T |
 |
| Q |
105 |
cacaaatcataagcactaaaccatgaagttaaattcataaaacattagtagtgtaccatcaccctgctatataatatgcattaatctattttctactct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495513 |
cacaaatcataagcactaaaccatgaagttaaattcataaaacattagtagtgtaccatcaccctgctatataatatgcattaatctattttctactct |
39495611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University