View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_463 (Length: 223)
Name: NF8260A_low_463
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_463 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 51 - 174
Target Start/End: Complemental strand, 7011728 - 7011605
Alignment:
| Q |
51 |
ccattactcaatggagtagagtaacctatgacttttgacatcatgttcttatgttggattggttgaagcatcatacttttgtgactgagatcctgtctta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7011728 |
ccattactcaatggagtagagtaacctatgacttttgacatcatgttcttatgttggattggttgaagcatcatacttttgtgactgagatcctgtctta |
7011629 |
T |
|
| Q |
151 |
gctttttaagatctggtcttctag |
174 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7011628 |
gctttttaagatctggtcttctag |
7011605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University