View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_474 (Length: 221)
Name: NF8260A_low_474
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_474 |
 | |
|
| [»] scaffold0491 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 22 - 174
Target Start/End: Original strand, 1542871 - 1543023
Alignment:
| Q |
22 |
attcccccacgcaacttcttcgtaatcatcattgtatacgtcaattgctattatgcttccagcctcgctgcaagttatggcttgccaattacaacgatca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
1542871 |
attcccccacgcaacttcttcgtaatcatcattggatatgtcaattgctattatgcttccagcctcgttgcaagttatggctttccaattacaacgatca |
1542970 |
T |
|
| Q |
122 |
cgaataatgaagcgtgcatcatacacattccaccatccactattccatatagc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1542971 |
cgaataatgaagcgtgcatcatacacattccaccatccactattcaatatagc |
1543023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 22 - 174
Target Start/End: Complemental strand, 1104557 - 1104405
Alignment:
| Q |
22 |
attcccccacgcaacttcttcgtaatcatcattgtatacgtcaattgctattatgcttccagcctcgctgcaagttatggcttgccaattacaacgatca |
121 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| | ||||| || |||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
1104557 |
attcccccacgcaactttttcataatcatcattgtatatgacaatttcttttatgcttccagccacgttgcaagttatggcttgccaattacaacgatca |
1104458 |
T |
|
| Q |
122 |
cgaataatgaagcgtgcatcatacacattccaccatccactattccatatagc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
1104457 |
cgaataatgaagcgtgcatcagacacattccaccatccactattcaatatagc |
1104405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0491
Description:
Target: scaffold0491; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 7682 - 7736
Alignment:
| Q |
65 |
attgctattatgcttccagcctcgctgcaagttatggcttgccaattacaacgat |
119 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| ||| | |||||||||||||||| |
|
|
| T |
7682 |
attgctattatgcttccagcatcgttgcaagatataccatgccaattacaacgat |
7736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University