View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_476 (Length: 220)
Name: NF8260A_low_476
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_476 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4082849 - 4082634
Alignment:
| Q |
1 |
ttttgtttcttggcaaatgatgattgaagggtgtctggggaattcaaattcctatagaaatatatatg--gttttgggaaatgatcaaatggaaannnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4082849 |
ttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatggaaattttg |
4082750 |
T |
|
| Q |
99 |
nnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtctaaacttgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082749 |
ttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtctaaacttgg |
4082650 |
T |
|
| Q |
199 |
aaaatttagttgatag |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4082649 |
aaaatttagttgatag |
4082634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University