View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_478 (Length: 219)
Name: NF8260A_low_478
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_478 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 6307177 - 6307374
Alignment:
| Q |
22 |
ttattgactatgtgaatgtaaacaatatctaaccgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307177 |
ttattgactatgtgaatgtaaacaatatctaactgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatac |
6307276 |
T |
|
| Q |
122 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307277 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgta |
6307374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University