View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_482 (Length: 217)
Name: NF8260A_low_482
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_482 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 24 - 178
Target Start/End: Original strand, 3726700 - 3726854
Alignment:
| Q |
24 |
aataattcatggacaagtgtgggtagtttgttgtcaaaggttgctatccttcatgttttatggtaaatattacaacttcctgagaattccatgttattta |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3726700 |
aataattcatggacaagtgtgggtagaatgttgtcaaaggttgctatccttcatgttttatggtaaatattacaacttcctgagaattccatgttattta |
3726799 |
T |
 |
| Q |
124 |
tttgtcatgttagcttctactggtgtgtcttaggacatagtattaaactattgat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3726800 |
tttgtcatgttagcttctactggtgtgtcttaggacatggtattaaactattgat |
3726854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University