View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8260A_low_487 (Length: 215)

Name: NF8260A_low_487
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8260A_low_487
NF8260A_low_487
[»] chr6 (1 HSPs)
chr6 (1-215)||(9538535-9538748)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 9538535 - 9538748
Alignment:
1 ggttggtatggttaatttggtgggaatgtaaagaacaaagaacaatgttgaggttaggatagatgcaataatgaaaattttgatatccatttgagagatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9538535 ggttggtatggttaatttggtgggaatgtaaagaacaaagaacaatgttgaggttaggatagatgcaataatgaaaattttgatatccatttga-agatg 9538633  T
101 gatgattgtgaagaaattaagtttgagaattggagagaaagttagaagaaaaaatgtatgagagttgagtaaagagtaatgaagaagtggttaaatgctt 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
9538634 gatgattgtgaagaaattaagtttgagaattggagaggaagttagaagaaaaaatatatgagagttgagtaaagagtcatgaagaagtggttaaatgctt 9538733  T
201 tgataaaggaactta 215  Q
    ||||||||| |||||    
9538734 tgataaagggactta 9538748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University