View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_494 (Length: 212)
Name: NF8260A_low_494
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_494 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 25 - 203
Target Start/End: Original strand, 43098816 - 43098994
Alignment:
| Q |
25 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacaggctaacagcagcttgcaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
43098816 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagctgcttgcaaa |
43098915 |
T |
|
| Q |
125 |
atgcaaaatcatatagtactactgtctaaaacttggatgtcaggtctagctcaccgtttgatgacacttacattagtat |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43098916 |
atgcaaaatcatatagtactaccgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattagtat |
43098994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University