View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_505 (Length: 208)
Name: NF8260A_low_505
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_505 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 34899715 - 34899524
Alignment:
| Q |
1 |
ttattataacatttgcatatgcttgtgtggtacgttacgcataaaaaccaagtggaacatgtcaactgacccactaattgaggttctcctaataactaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34899715 |
ttattataacatttgcatatgcttgtgtggtac-ttacgcataaaaaccaagtggaacatgtcaactgacccactagttgaggttctcctaataactaag |
34899617 |
T |
 |
| Q |
101 |
aacatttttagagacacattttcgatattcaattttctgcattcagctaccagctaattatttgtaagtcttagcagacacttcttcatagat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899616 |
aacatttttagagacacattttcgatattcaattttctgcattcagctaccaactaattatttgtaagtcttagcagacacttcttcatagat |
34899524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University