View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_508 (Length: 208)
Name: NF8260A_low_508
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_508 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 38 - 173
Target Start/End: Complemental strand, 52491207 - 52491072
Alignment:
| Q |
38 |
tcttcctctttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaagcgttcgtcgtgtgttgattagcgcacctctctccggtgac |
137 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52491207 |
tcttcttctttcaagcagctgtcacaagagccgcaaggttcatttcaccgccccatcaaacgtccgtcgtgtgttgattagcgcacctctctctggtgac |
52491108 |
T |
|
| Q |
138 |
cttcgttcaaagtacaatgtgtgttctcttcccgtt |
173 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |
|
|
| T |
52491107 |
cttcgttcaaagtacatcgtgcgttctcttcccgtt |
52491072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 46 - 173
Target Start/End: Original strand, 5404205 - 5404332
Alignment:
| Q |
46 |
tttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaagcgttcgtcgtgtgttgattagcgcacctctctccggtgaccttcgttc |
145 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| ||||||| |||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
5404205 |
tttcaagcagccgtcgcaagagccgcaaggctcatttcaccgccccatcaagcgtccgtcgtgtgttgatgagcgcacctctttccggtgacctccgttc |
5404304 |
T |
|
| Q |
146 |
aaagtacaatgtgtgttctcttcccgtt |
173 |
Q |
| |
|
||||||||| ||| |||||||||||||| |
|
|
| T |
5404305 |
aaagtacaacgtgcgttctcttcccgtt |
5404332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 38 - 115
Target Start/End: Original strand, 21946227 - 21946304
Alignment:
| Q |
38 |
tcttcctctttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaagcgttcgtcgtgtgttgat |
115 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||||||||||||| |||||| |||||| ||| |||||||||||||| |
|
|
| T |
21946227 |
tcttcttctttcaagcatccgtcgcaagagccgcaaggttcattttaccgccacaccaaacgtccgtcgtgtgttgat |
21946304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 30927147 - 30927076
Alignment:
| Q |
102 |
cgtcgtgtgttgattagcgcacctctctccggtgaccttcgttcaaagtacaatgtgtgttctcttcccgtt |
173 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
30927147 |
cgtcgtgtgttgatgagcgaacctctctccggtgaccttctttcaaagtacaacgtgcattctcttcccgtt |
30927076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University