View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_517 (Length: 205)
Name: NF8260A_low_517
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_517 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 29006051 - 29005846
Alignment:
| Q |
1 |
tagtatgggtatttggaggtgcctatggttatgctagtaatcnnnnnnnn-ctcattttactcctcattgggaaagtggctctatgggaagtgaggaatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29006051 |
tagtatgggtatttggaggtgcctatggttatgctagtaatctttttttttctcattttactcctcattgggaaagtggctctatgggaagtgaggaatg |
29005952 |
T |
 |
| Q |
100 |
agtgtatcttttctaatttggtgcttcatggaagacatgggcacatggtgattttcttagtagcagagacaaaagtagcaagattaggttaaaatagaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29005951 |
agtgtatcttttctaatttggtgcttcatggaagacataggcacatggtgattttcttagtagcagagacaaaagtagcaatattaggttaaaatagaaa |
29005852 |
T |
 |
| Q |
200 |
tggtag |
205 |
Q |
| |
|
|||||| |
|
|
| T |
29005851 |
tggtag |
29005846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University