View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_76 (Length: 374)
Name: NF8260A_low_76
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 10119903 - 10119532
Alignment:
| Q |
1 |
gagaaggagtgttgcttttggtacaagcaaaaggaac-gcaaagcgccatatttctattaaaccgttatat----ctttaaagcaatgtaaaatatcaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10119903 |
gagaaggagtgttgcttttggtacaagcaaaaggaaccgcaaagcgccatatttctattaaaccgttatatatatctttaaagcaatgtaaaatatcaaa |
10119804 |
T |
|
| Q |
96 |
cactcaaccatgttataaccgtccctatattttcatttcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaacagga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119803 |
cactcaaccatgttataaccgtccctatattttcattgcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaacagga |
10119704 |
T |
|
| Q |
196 |
cggtccaatcggttgtaccttaaactgacggtttggttattttagcggttcaataccagtttcgttcgggttcaagcaatttaaggcagttgaaccatga |
295 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119703 |
cggttcaatcggttgtaccttaaactgacggtttggtta-tttagcggttcaatcccagtttcgttcgggttcaagcaatttaaggcagttgaaccatga |
10119605 |
T |
|
| Q |
296 |
accatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119604 |
accatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
10119532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University