View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_92 (Length: 352)
Name: NF8260A_low_92
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 7 - 341
Target Start/End: Original strand, 36170376 - 36170710
Alignment:
| Q |
7 |
gttggtgttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170376 |
gttggtgttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
36170475 |
T |
 |
| Q |
107 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170476 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
36170575 |
T |
 |
| Q |
207 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170576 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
36170675 |
T |
 |
| Q |
307 |
ggttttgtggatcagttgctatattttcttcgaca |
341 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |
|
|
| T |
36170676 |
ggttttgtggatcagttgctatattatgttcgaca |
36170710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 279 - 341
Target Start/End: Complemental strand, 1286394 - 1286332
Alignment:
| Q |
279 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatattttcttcgaca |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
1286394 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatattatgttcgaca |
1286332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University