View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260A_low_97 (Length: 350)
Name: NF8260A_low_97
Description: NF8260A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260A_low_97 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 16160661 - 16161005
Alignment:
| Q |
1 |
tggtgttgccggttctgttgagagtacttccttggcctttggtgctgaacatgaatctgctttcaaggctaatggatctggtgtcaaaagaaatctttct |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
16160661 |
tggtgttgccggttctgctgagagtacttccttggccgttggtgctgaacatgaatctgctttcaa-----atggatctggtgccaaaagaaatctttct |
16160755 |
T |
 |
| Q |
101 |
tctgcctttgttgaagttgactctgatgatgagactcttgcctagaaatatggaaggattagaaagggttgaacgtagtggttggttatcgaactgtctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16160756 |
tctgcctttgttgaagttgactctgatgatgagactcttgcccagaaatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtctg |
16160855 |
T |
 |
| Q |
201 |
agttatcgtttgtaataatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatatggactccc |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16160856 |
agttatcgtttgtagtaatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactccc |
16160955 |
T |
 |
| Q |
301 |
tcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtga |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16160956 |
tcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtga |
16161005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University