View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260_high_15 (Length: 264)
Name: NF8260_high_15
Description: NF8260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260_high_15 |
 |  |
|
| [»] scaffold0902 (1 HSPs) |
 |  |  |
|
| [»] scaffold1652 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold1801 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 37253065 - 37252927
Alignment:
| Q |
20 |
cttactccatcatccatctccactcctccttctgaaggaccttccgaaaacggcgccgctttgaacagatttaccgttgccggatctgctgctgtggtgg |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37253065 |
cttactccatcatccatttccactcctccttccgaaggaccttccgaaaacggtgccgctttgaacagatttaccgttgccggatctgctgctgtagtgg |
37252966 |
T |
 |
| Q |
120 |
ttttcgccgccgctttgatgctatagagagttactcgag |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37252965 |
ttttcgccgccgctttgatactatagagagttactcgag |
37252927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 21 - 155
Target Start/End: Complemental strand, 37232815 - 37232684
Alignment:
| Q |
21 |
ttactccatcatccatctccactcctccttctgaaggaccttccgaaaacggcgccgctttgaacagatttaccgttgccggatctgctgctgtggtggt |
120 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| || |||||||||||||||||| ||||| ||||||||||||||||||||||| ||| | |
|
|
| T |
37232815 |
ttactccatcatcgatctccactcctcctgctgaagcaccatc---aaacggcgccgctttgaatagattcaccgttgccggatctgctgctgttgtgat |
37232719 |
T |
 |
| Q |
121 |
tttcgccgccgctttgatgctatagagagttactc |
155 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||| |
|
|
| T |
37232718 |
tttcgctgccgctttgatgatgtagagagttactc |
37232684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 146
Target Start/End: Complemental strand, 37244960 - 37244881
Alignment:
| Q |
67 |
aaacggcgccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctataga |
146 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||| ||||||||||| || | ||||||| |||||| |
|
|
| T |
37244960 |
aaacggcgccgctttcaacagattcactgttgccggatctgctgctgttgtggttttcgctgctgttttgatgatataga |
37244881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 21 - 151
Target Start/End: Complemental strand, 37257198 - 37257059
Alignment:
| Q |
21 |
ttactccatcatccatctccactcctccttctgaag------gaccttccgaaaa---cggcgccgctttgaacagatttaccgttgccggatctgctgc |
111 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| |||||| || || || ||||||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
37257198 |
ttactccatcatccatctctactactccttctgaagcaccttcaccttcagacaactccgccgccgcttttaacagattcaccgttgctggatctgctgc |
37257099 |
T |
 |
| Q |
112 |
tgtggtggttttcgccgccgctttgatgctatagagagtt |
151 |
Q |
| |
|
||| ||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
37257098 |
tgttatggttttcgccgctgctttgatgatgtagagagtt |
37257059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 63
Target Start/End: Complemental strand, 37237742 - 37237700
Alignment:
| Q |
21 |
ttactccatcatccatctccactcctccttctgaaggaccttc |
63 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
37237742 |
ttactccatcatccatctctactcctccttctgaagcaccttc |
37237700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 68 - 152
Target Start/End: Complemental strand, 14316766 - 14316682
Alignment:
| Q |
68 |
aacggcgccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagtta |
152 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||| || ||||||||| | |||||||||| |
|
|
| T |
14316766 |
aacgacgccgctttgaacagatttacccttgccggatctgctgctgtcgtggttttcgctgctgctttgatgatgtagagagtta |
14316682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 67 - 152
Target Start/End: Complemental strand, 14254039 - 14253954
Alignment:
| Q |
67 |
aaacggcgccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagtta |
152 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| || ||||||||| | |||||||||| |
|
|
| T |
14254039 |
aaacgacgccgctttgaacagatttacagttgctggatctgctgctgtcgtggttttcgctgctgctttgatgatgtagagagtta |
14253954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 73 - 152
Target Start/End: Complemental strand, 14248223 - 14248144
Alignment:
| Q |
73 |
cgccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagtta |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |||||||| | || ||||||||| | |||||||||| |
|
|
| T |
14248223 |
cgccgctttgaacagatttacagttgccggatctactgctgtcgtggtttttgttgctgctttgatgatgtagagagtta |
14248144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 75 - 152
Target Start/End: Complemental strand, 3277 - 3200
Alignment:
| Q |
75 |
ccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagtta |
152 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| | || ||||||||| | |||||||||| |
|
|
| T |
3277 |
ccgctttgaacagatttacagttgccggatctgctgctgtcgtggttttcacggctgctttgatgatgtagagagtta |
3200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold1652
Description:
Target: scaffold1652; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 78 - 153
Target Start/End: Original strand, 595 - 670
Alignment:
| Q |
78 |
ctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagttac |
153 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| | || ||||||||| | ||||||||||| |
|
|
| T |
595 |
ctttgaacagatttacagttgccggatctgctgctgtcgtggttttcactgctgctttgatgatgtagagagttac |
670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 73 - 152
Target Start/End: Original strand, 371 - 450
Alignment:
| Q |
73 |
cgccgctttgaacagatttaccgttgccggatctgctgctgtggtggttttcgccgccgctttgatgctatagagagtta |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| ||||||||| || ||||||||| | |||||||||| |
|
|
| T |
371 |
cgccgctttgaacagatttacagttgccggatctactgctgtcgtggttttcattgctgctttgatgatgtagagagtta |
450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1801 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold1801
Description:
Target: scaffold1801; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 74 - 114
Target Start/End: Original strand, 268 - 308
Alignment:
| Q |
74 |
gccgctttgaacagatttaccgttgccggatctgctgctgt |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
268 |
gccgctttgaacagatttacagttgccggatctgctgctgt |
308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University