View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260_high_9 (Length: 341)
Name: NF8260_high_9
Description: NF8260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 204 - 328
Target Start/End: Complemental strand, 5402076 - 5401952
Alignment:
| Q |
204 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402076 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
5401977 |
T |
 |
| Q |
304 |
gatacgtgtagaaggaacctgtttt |
328 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5401976 |
gatacgtgtagaaggaacctgtttt |
5401952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 5402272 - 5402216
Alignment:
| Q |
13 |
atgaagggttggaaccaaattggtatcattgaaaccatttacgaggaagaacgtgaa |
69 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5402272 |
atgaagggttggaaccaaattggtgtcattgaaaccatttacgaggaagaacgtgaa |
5402216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University