View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8260_low_19 (Length: 249)
Name: NF8260_low_19
Description: NF8260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8260_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 48 - 228
Target Start/End: Complemental strand, 5034712 - 5034536
Alignment:
| Q |
48 |
caatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacctgttttatgtttaccattcaacaaaactttttacttttggttgaatct |
147 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| | | ||||||| ||||||||||||| |
|
|
| T |
5034712 |
caatcttcctttatgtgcttagaatgttaataattattcaaagtcttttaccagttttatgtttaacattcaatacatcttttta-atttggttgaatct |
5034614 |
T |
 |
| Q |
148 |
ccaaatatctattccattcatcattttgatattaaattagaaacttctctaaacatggttaaatagttcttgttcgtgact |
228 |
Q |
| |
|
|| ||||||||| ||| |||| ||||| | |||||||||||||||| || |||||| ||||||| |||||| ||||| |
|
|
| T |
5034613 |
cctgatatctatttcat---tcatattgatgtgaaattagaaacttctccaagcatggtgaaatagtcattgttcatgact |
5034536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 2489542 - 2489480
Alignment:
| Q |
10 |
atcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaat |
72 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2489542 |
atcaaccttgtttcaattatactttggtttcttactcacaatctgcctttatgtgcttcgaat |
2489480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 2626952 - 2627044
Alignment:
| Q |
8 |
atatcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacct |
100 |
Q |
| |
|
||||||||||| |||| |||||| || | ||||||||| | |||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
2626952 |
atatcaaccttatgtctattagacttgagcttcttactcggattctgcctttatgtgtttagaatgtcaataattacctaaagtcttttacct |
2627044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 196
Target Start/End: Complemental strand, 2489483 - 2489432
Alignment:
| Q |
142 |
gaatctccaaatatctattccattcatcattttgatattaaattagaaacttctc |
196 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
2489483 |
gaatctctaaatatctatttcattcat---tttgattttaaattagaaacttctc |
2489432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 39536878 - 39536963
Alignment:
| Q |
72 |
tgtcaataattattcaaagtcttttacctgttttatgtttaccattcaacaaaactttttacttttggttgaatctccaaatatctat |
159 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||||||||| | ||||||||| ||||| | ||||||||| |||| ||| |||||| |
|
|
| T |
39536878 |
tgtcaataattactcaaagtcttttacatattttatgtttatcgttcaacaaagcttttaa--tttggttgactctctaaacatctat |
39536963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University