View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_high_11 (Length: 446)
Name: NF8261_high_11
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 7 - 324
Target Start/End: Original strand, 35465308 - 35465625
Alignment:
| Q |
7 |
gaagcagagaaccagtcaaagagagtatatcaaatctccctggaagcgctaccatagctccgggacctgtaggttgccggagagaaacgttaacgacggt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35465308 |
gaagcacagaaccagtcaaagagagtatatcaaatctccctggaagcgctaccacagctccgggacctgtaggttgccggagagaaacgttaacgacggt |
35465407 |
T |
 |
| Q |
107 |
tccacttgcgcttagaatgcaaatacctctctgtctttttcttgcaaactgaacgatgctatctgatatatctgttcctgttgctacttccatgacatgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35465408 |
tccacttgcgcttagaatgcaaatacctctctgtctttttcttgcaaactgaacgatgctatctgatatatctgttcctgttgctacttccatgacatgg |
35465507 |
T |
 |
| Q |
207 |
cttcgtagcgcgttagggctatctcttgttatgaatattggtggttttggtttgttttttgaacctgatggacggcctcttgggcggcgcgtggaggtgt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35465508 |
cttcgtagcgcgttagggctatctcttgttatgaatattggtggttttggtttgttttttgaacctgatggacggcctcttgggcggcgcgtggaggtgt |
35465607 |
T |
 |
| Q |
307 |
ttgtttctattgcacctc |
324 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35465608 |
ttgtttctattgcacctc |
35465625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 228 - 271
Target Start/End: Complemental strand, 16578683 - 16578640
Alignment:
| Q |
228 |
tctcttgttatgaatattggtggttttggtttgttttttgaacc |
271 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
16578683 |
tctcttgttacgaagattggtggttttggtttgttttttgaacc |
16578640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 397 - 430
Target Start/End: Original strand, 35465695 - 35465728
Alignment:
| Q |
397 |
ctcctgttacagcactttgattcatggagaaacc |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35465695 |
ctcctgttacagcactttgattcatggagaaacc |
35465728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University