View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8261_high_25 (Length: 255)

Name: NF8261_high_25
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8261_high_25
NF8261_high_25
[»] chr2 (1 HSPs)
chr2 (40-237)||(7422969-7423167)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 40 - 237
Target Start/End: Complemental strand, 7423167 - 7422969
Alignment:
40 ttatgttcaagacttcaagtcatataagatagcaaaagaaaaatgcaaaatattaataagcatacgtc-gcttgatttaacacttcatgcgagcagacag 138  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
7423167 ttatgttcaagacttcaagtcatataagatagcaaaagaaaaatgcaaaatattaataagcatacgtcagcttgatttaacacttcatgcgagcagacag 7423068  T
139 atggttgtgattggctcttgttcgagggccataatccatgtactgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaa 237  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7423067 atggttgtgattggcccttgttcgagggccataatccatgtactgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaa 7422969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University