View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_30 (Length: 341)
Name: NF8261_low_30
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 17 - 341
Target Start/End: Original strand, 29372696 - 29373020
Alignment:
| Q |
17 |
catcatattaaaaagaggtcattggtattcatgacaaagttctcgtaggaacaatattttattacaagatctaatagcgcgcttgcagcttgagggacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29372696 |
catcatattaaaaagaggtcattggtattcgtgacaaagttctcgtaggaacaatattttattacaagatataatagcgcgcttgcagcttgagggacac |
29372795 |
T |
 |
| Q |
117 |
ttggcaagtatatcaaattgttcaagtaataatattggtttatggcttgaattgaattttattgccccgaataatttgttcatccacttggagtgttggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29372796 |
ttggcaagtatatcaaattgttcaagtaataatattggtttatggcttgaattgaattttattgcctcgaataatttgttcatccacttggagtgttggc |
29372895 |
T |
 |
| Q |
217 |
gggatagagcgaaagtgaataaattgaagagaggttatgtgtttatttcgcatgccgttctttgggttatttggagataacaagatgggagaattttcaa |
316 |
Q |
| |
|
||||| |||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29372896 |
gggatggagcgagagtgaataaattgaagataggttatgtgtttatttggcatgccgttctttgggttatttggagataacaaaatgggagaattttcaa |
29372995 |
T |
 |
| Q |
317 |
tgataaaggaaaggatattgatgag |
341 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29372996 |
tgataaaggaaaggatattgatgag |
29373020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 45088011 - 45087928
Alignment:
| Q |
18 |
atcatattaaaaagaggtcattggtattcatgacaaagttctcgtaggaacaatattttattacaagatctaatagcgcgcttg |
101 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||||||| || ||||||||| |||| |||||| ||||||| |
|
|
| T |
45088011 |
atcatattaaaaagagttcatcagtattcataacaaagttctcgtaggaacgatgttttattacgagatataatagtgcgcttg |
45087928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University