View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_33 (Length: 320)
Name: NF8261_low_33
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 17499075 - 17499246
Alignment:
| Q |
18 |
aagataagtgttggtgttggtttttggagattataaggtaacaaaggtttgtagtaacggtttaagggttgaattgttatagtggcggttaatcctgccg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17499075 |
aagataagtgttggtgttggtttttggagattataaggtaacaaaggtttgtagtaacggtttaagggttgaattgttatagtggcggttagtcctgccg |
17499174 |
T |
|
| Q |
118 |
ccataggtgaagtttggnnnnnnngagttgaaaaaacttgatgcttgagtttatagttgtggaagagtttct |
189 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17499175 |
ccataggtgaagtttggtttttttgagttgaaaaaacttgatgcttgagtttatagttgtggaagagtttct |
17499246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 207 - 308
Target Start/End: Original strand, 17499274 - 17499375
Alignment:
| Q |
207 |
ttgattgtgtaaagtgtgtgattgtgtattgtgaagatggaataggtgttggagtgaaggtttaaaaaggaggaggaatagagaccatagcttttgtgat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17499274 |
ttgattgtgtaaagtgtgtgattgtgtattgtgaagatggaataggtgttggagtgaaggtttaaaaaggaggaagaatagagaccatagcttttgtgat |
17499373 |
T |
|
| Q |
307 |
gt |
308 |
Q |
| |
|
|| |
|
|
| T |
17499374 |
gt |
17499375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University