View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_41 (Length: 277)
Name: NF8261_low_41
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 262
Target Start/End: Original strand, 26777 - 27024
Alignment:
| Q |
15 |
tgaaaacaaactgaagaattgcaatcaacaaggtaaacatagtgcataatataaataattagctattaggtatacgatgtaactaagaaacttcagttaa |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26777 |
tgaaaacaaactgaagaattgcattcaacaaagtaaacatagtgcataatataaataattagctattagttatacgatgtaactaagaaacttcagttaa |
26876 |
T |
|
| Q |
115 |
ctgctnnnnnnnctcaagcataaactaaatttgatcttaattggtgtctaaggtagatatatgtataaccactccctaaatgcatgtctccatagtacag |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26877 |
ctgctaaaaaaactcaagcataaactaaatttgatcttaattggtgtctaaggtagatatatgtataaccactccctaaatgcatgtctccatagtacag |
26976 |
T |
|
| Q |
215 |
agatcagtttagccattggggttttttcttttgtaatatgattatatg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26977 |
agatcagtttagccattggggttttttcttttgtaatatgattatatg |
27024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University